Embedded Files
This is a comprehensive list of lab procedures required to make a Psiloscoby.
☐ Get these Plasmids:
To understand these plasmids more, you can read: Deconvoluting Milne et al.2020 ,Genes for Psilocybin's Enzymatic Pathway , and Plasmids for Genomic Integration of Psilocybin's Enzymatic Pathway in S. Cerevisiae
☐ Get these Primers:
Order these primers, probably from IDT
NESS84 - CCACCGAAGTTGATTTGCTT
Fwd primer for diagnostic PCR of EasyClone plasmid integration at XII-5 site
NESS85 - GTGGGAGTAAGGGATCCTGT
Rev primer for diagnostic PCR of EasyClone plasmid integration at XII-5 site
NESS86 - CTTAATGGGTAGTGCTTGACACG
Fwd primer for diagnostic PCR of EasyClone plasmid integration at XI-1 site
NESS87 - GAAGACCCATGGTTCCAAGGA
Rev primer for diagnostic PCR of EasyClone plasmid integration at XI-1 site
NESS88 - GTGCTTGATTTGCGTCATTC
Fwd primer for diagnostic PCR of EasyClone plasmid integration at XI-3 site
NESS89 - CACATTGAGCGAATGAAACG
Rev primer for diagnostic PCR of EasyClone plasmid integration at XI-3 site
☐ Miniprep the Glycerol Stocks
with ZymoPURE Plasmid Miniprep Kit
Some of these plasmids come in E.coli glycerol stocks which need the plasmid DNA extracted from the cells.
Inoculate labeled culture tubes of 5 ml LB + 5 ul Amp with corresponding glycerol stocks, grow at 37C for 16 hrs.
The following procedure should be performed at room temperature (15-30°C).
Centrifuge 0.5-5 ml of bacterial culture in a clear 1.5 ml tube at full speed for 15-20 seconds in a microcentrifuge.
Discard supernatant.
Add 250 µl of P1 (Red) to the bacterial cell pellet and resuspend completely by vortexing or pipetting.
Add 250 µl of P2 (Green) and immediately mix by gently inverting the tube 8-10 times.
Do not vortex!
Let sit at room temperature for 3 minutes. Cells are completely lysed when the solution appears clear, purple, and viscous.
Add 250 µl of P3 (Yellow) and mix thoroughly by inversion.
Do not vortex!
Invert the tube an additional 5 times after the sample turns completely yellow. The sample will turn yellow when the neutralization is complete, and a yellowish precipitate will form.
Centrifuge for 5 minutes at 16,000 x g.
Transfer exactly 600 µl of supernatant into a clean 1.5 ml microcentrifuge tube.
Add 260 µl of Binding Buffer to the cleared lysate from and mix thoroughly by vortexing for 15 seconds.
Place a Column in a Collection Tube.
Transfer the entire mixture from step 7 into the Column.
Incubate the Collection Tube assembly at room temperature for 1 minute and then centrifuge at ≥ 10,000 x g for 1 min. Discard the flow through.
Add 800 µl of Wash 1 to the Column and centrifuge at ≥ 10,000 x g for 1 min. Discard the flow through.
Add 800 µl of Wash 2 to the Column and centrifuge at ≥ 10,000 x g for 1 min. Discard the flow through.
Add 200 µl of Wash 2 to the Column and centrifuge at ≥ 10,000 x g for 1 min. Discard the flow through.
Centrifuge the Column at ≥ 10,000 x g for 1 minute in order to remove any residual wash buffer.
Transfer the Column into a clean 1.5 ml tube and add 25 µl of Elution Buffer directly to the column matrix. Incubate at room temperature for 2 minutes, and then centrifuge at ≥ 10,000 x g for 1 minute in a microcentrifuge. Store the eluted plasmid DNA at ≤ -20°C.
☐ Make YPD + Agar + G418 Plates
15 g YPD
6.9 g Agar
300mls water
Autoclave
make 200 mg/ml stock solution of G418:
2 g G418 into 10 mls water
300 ul of 200 mg/ml G418 stock solution into cool 300 ml of YPD Agar
pour ~25 mls into each plate
☐ Make CEN.PK.113-5D competent,
with Zymo's Frozen-EZ Yeast Transformation Kit
Grow yeast cells at 30C in 5 ml (grow 10ml but only use 5 ml) YPD until mid-log phase, higher cell density is better than lower cell density
At room temp, divide cells up into 5 eppitubes, ~ 1.5 ml each tube
Pellet the cells at 500x g for 4 minutes and discard the supernatant.
Add 500 ul of Solution 1 to wash the pellet.
Repellet at 500x g for 4 minutes. Discard supernatant.
Add 50 ul of Solution 2 to resuspend pellet.
This yields 5 eppitubes with 50 ul of cells each (one transformations per tube).
Can use immediately or freeze for later use.
☐ Transform pCfB2312 (Cas9) into competent CEN.PK.113-5D
with Zymo's Frozen-EZ Yeast Transformation Kit
Mix 50 ul of comp cells with .2-1 ug DNA (in less than 5 ul),
Also do a (-) control with no DNA
And 500 ul Solution 3 and mix thoroughly
Incubate at 30C for 45 mins, Mix vigorously by flicking with finger 2-3 times during this incubation
Spread 50-150 ul of transformation mix on YPD + G418 plates.
Incubate plates at 30C for 2-4 days
☐ STRAIN1a
(CEN.PK.113-5D + pCfB2312)
☐ Linearize p1, p2, and p3 with Not1
Mix the following:
X μl of plasmid p1 (min 1 μg)
2 µl of 10x Buffer O
1 μl of NotI
water up to 20 µl
Incubate at 37°C for 1 hour.
☐ Make STRAIN1a competent
with Zymo's Frozen-EZ Yeast Transformation Kit
Grow yeast cells at 30C in 5 ml (grow 10ml but only use 5 ml) YPD until mid-log phase, higher cell density is better than lower cell density
At room temp, divide cells up into 5 eppitubes
Pellet the cells at 500x g for 4 minutes and discard the supernatant.
Add 500 ul of Solution 1 to wash the pellet.
Repellet at 500x g for 4 minutes. Discard supernatant.
Add 50 ul of Solution 2 to resuspend pellet.
This yields 5 eppitubes with 50 ul of cells each (one transformations per tube).
☐ Transform pCfB3050 (gRNA for XII-5) and linearized p1 into competent STRAIN1a
with Zymo's Frozen-EZ Yeast Transformation Kit
Mix 50 ul of comp cells with .2-1 ug DNA (in less than 5 ul),
Also do a (-) control with no DNA
And 500 ul Solution 3 and mix thoroughly
Incubate at 30C for 45 mins, Mix vigorously by flicking with finger 2-3 times during this incubation
Spread 50-150 ul of transformation mix on YPD + G418 plates.
Incubate plates at 30C for 2-4 days
☐ Verify Integration at XII-5 with Genomic DNA Extraction, PCR Amplification and Visualization
Genomic DNA Extraction
PCR
Gel Visualization
☐ Make YPD + G418 + nourseothricin Plates
15 g YPD
6.9 g Agar
300mls water
Autoclave
make 200 mg/ml stock solution of G418:
2 g G418 into 10 mls water
300 ul of 200 mg/ml G418 stock solution into cool 300 ml of YPD Agar
pour ~25 mls into each plate
☐ Verify that gRNA plasmid pCfB3050 is knocked out
Replica Plate on YPD + G418 + nourseothricin
Incubate plates at 30C for 2-4 days
☐ Verify Expression with RNA Extraction and rtPCR
RNA Extraction:
Before starting, add 24 ml 100% ethanol to the 6 ml RNA wash buffer
Add 200 ul Zymolase Storage Buffer to the lyophilized Zymolase, store in frozen aliquots
Grow yeast in overnight culture in YPD and G418 at 30C
Spin 1-5 x 10^7 cells (1-1.5 ml culture) at 500g for 2 mins, remove supernatent
Add 80 ul of YR Digestion Buffer and 5 ul of the Zymolase to the cell pellet and resuspend
Incubate the suspension at 30-37C for 40-60 mins
Add 160ul of YR Lysis Buffer and mix
Add an equal volume of 95-100% Ethanol (1:1) and mix
Transfer to the column plus collection tube assembly and centrifuge >10,000xg for 30 sec, discard flow through
Add 200ul RNA Wash Buffer to the column and centrifuge >10,000xg for 30 sec
Repeat above step
Transfer to an eppitube
Add 60 ul of RNase free water to the column and >10,000xg for 30 sec
Create a cDNA Library with ZymoScript One-Step RT-qPCR Kit
Reagent
Amount/rxn
Thaw reagents at room temp
Mix by inversion
Briefly centrifuge, place on ice
Add all components except RNA template,
Mix and briefly centrifuge
Aliquot master mix into PCR strip tubes, add RNA template
Put in thermalcycler and start the protocol:
Thermalcycler Protocol:
55C 10min
95C 10min
Cycle 30-40x:
95C 20sec
60C 60sec for <1kb *do 90sec*
4C
Primer Pairs:
☐ STRAIN1b
(CEN.PK.113-5D + pCfB2312 + p1)
☐ Make STRAIN1b competent
with Zymo's Frozen-EZ Yeast Transformation Kit
Grow yeast cells at 30C in 5 ml (grow 10ml but only use 5 ml) YPD until mid-log phase, higher cell density is better than lower cell density
At room temp, divide cells up into 5 eppitubes
Pellet the cells at 500x g for 4 minutes and discard the supernatant.
Add 500 ul of Solution 1 to wash the pellet.
Repellet at 500x g for 4 minutes. Discard supernatant.
Add 50 ul of Solution 2 to resuspend pellet.
This yields 5 eppitubes with 50 ul of cells each (one transformations per tube).
☐ Transform pCfB3045 (gRNA for XI-3) and p2 into competent STRAIN1b
with Zymo's Frozen-EZ Yeast Transformation Kit
Mix 50 ul of comp cells with .2-1 ug DNA (in less than 5 ul),
Also do a (-) control with no DNA
And 500 ul Solution 3 and mix thoroughly
Incubate at 30C for 45 mins, Mix vigorously by flicking with finger 2-3 times during this incubation
Spread 50-150 ul of transformation mix on YPD + G418 plates.
Incubate plates at 30C for 2-4 days
☐ Verify Integration at XI-3 with Genomic DNA Extraction, PCR Amplification and Visualization
NESS88 - GTGCTTGATTTGCGTCATTC
Fwd primer for diagnostic PCR of EasyClone plasmid integration at XI-3 site
NESS89 - CACATTGAGCGAATGAAACG
Rev primer for diagnostic PCR of EasyClone plasmid integration at XI-3 site
☐ Verify that gRNA plasmid pCfB3045 is knocked out
Replica Plate on YPD + G418 + nourseothricin
Incubate plates at 30C for 2-4 days
☐ Verify Expression with RNA Extraction and rtPCR
RNA Extraction:
Before starting, add 24 ml 100% ethanol to the 6 ml RNA wash buffer
Add 200 ul Zymolase Storage Buffer to the lyophilized Zymolase, store in frozen aliquots
Grow yeast in overnight culture in YPD and G418 at 30C
Spin 1-5 x 10^7 cells (1-1.5 ml culture) at 500g for 2 mins, remove supernatent
Add 80 ul of YR Digestion Buffer and 5 ul of the Zymolase to the cell pellet and resuspend
Incubate the suspension at 30-37C for 40-60 mins
Add 160ul of YR Lysis Buffer and mix
Add an equal volume of 95-100% Ethanol (1:1) and mix
Transfer to the column plus collection tube assembly and centrifuge >10,000xg for 30 sec, discard flow through
Add 200ul RNA Wash Buffer to the column and centrifuge >10,000xg for 30 sec
Repeat above step
Transfer to an eppitube
Add 60 ul of RNase free water to the column and >10,000xg for 30 sec
Create a cDNA Library with ZymoScript One-Step RT-qPCR Kit
Reagent
Amount/rxn
Thaw reagents at room temp
Mix by inversion
Briefly centrifuge, place on ice
Add all components except RNA template,
Mix and briefly centrifuge
Aliquot master mix into PCR strip tubes, add RNA template
Put in thermalcycler and start the protocol:
Thermalcycler Protocol:
55C 10min
95C 10min
Cycle 30-40x:
95C 20sec
60C 60sec for <1kb *do 90sec*
4C
Primer Pairs:
☐ STRAIN1c (CEN.PK.113-5D + pCfB2312 + p1 + p2)
☐ Linearize p3 with Not1
Mix the following:
X μl of plasmid p2 (min 1 μg)
2 µl of 10x Buffer O
1 μl of NotI
water up to 20 µl
Incubate at 37°C for 1 hour.
☐ Make STRAIN1c competent
with Zymo's Frozen-EZ Yeast Transformation Kit
Grow yeast cells at 30C in 5 ml (grow 10ml but only use 5 ml) YPD until mid-log phase, higher cell density is better than lower cell density
At room temp, divide cells up into 5 eppitubes
Pellet the cells at 500x g for 4 minutes and discard the supernatant.
Add 500 ul of Solution 1 to wash the pellet.
Repellet at 500x g for 4 minutes. Discard supernatant.
Add 50 ul of Solution 2 to resuspend pellet.
This yields 5 eppitubes with 50 ul of cells each (one transformations per tube).
☐ Transform pCfB3043 (gRNA for XI-1) and linearized p3 into competent STRAIN1c
with Zymo's Frozen-EZ Yeast Transformation Kit
Mix 50 ul of comp cells with .2-1 ug DNA (in less than 5 ul),
Also do a (-) control with no DNA
And 500 ul Solution 3 and mix thoroughly
Incubate at 30C for 45 mins, Mix vigorously by flicking with finger 2-3 times during this incubation
Spread 50-150 ul of transformation mix on YPD + G418 plates.
Incubate plates at 30C for 2-4 days
☐ Verify Integration at XI-1 with Genomic DNA Extraction, PCR Amplification and Visualization
NESS86 - CTTAATGGGTAGTGCTTGACACG
Fwd primer for diagnostic PCR of EasyClone plasmid integration at XI-1 site
NESS87 - GAAGACCCATGGTTCCAAGGA
Rev primer for diagnostic PCR of EasyClone plasmid integration at XI-1 site
☐ Verify that gRNA plasmid pCfB3043 is knocked out
Replica Plate on YPD + G418 + nourseothricin
Incubate plates at 30C for 2-4 days
☐ Verify Genomic Integration with RNA Extraction and rtPCR
RNA Extraction:
Before starting, add 24 ml 100% ethanol to the 6 ml RNA wash buffer
Add 200 ul Zymolase Storage Buffer to the lyophilized Zymolase, store in frozen aliquots
Grow yeast in overnight culture in YPD and G418 at 30C
Spin 1-5 x 10^7 cells (1-1.5 ml culture) at 500g for 2 mins, remove supernatent
Add 80 ul of YR Digestion Buffer and 5 ul of the Zymolase to the cell pellet and resuspend
Incubate the suspension at 30-37C for 40-60 mins
Add 160ul of YR Lysis Buffer and mix
Add an equal volume of 95-100% Ethanol (1:1) and mix
Transfer to the column plus collection tube assembly and centrifuge >10,000xg for 30 sec, discard flow through
Add 200ul RNA Wash Buffer to the column and centrifuge >10,000xg for 30 sec
Repeat above step
Transfer to an eppitube
Add 60 ul of RNase free water to the column and >10,000xg for 30 sec
Create a cDNA Library with ZymoScript One-Step RT-qPCR Kit
Reagent
Amount/rxn
Thaw reagents at room temp
Mix by inversion
Briefly centrifuge, place on ice
Add all components except RNA template,
Mix and briefly centrifuge
Aliquot master mix into PCR strip tubes, add RNA template
Put in thermalcycler and start the protocol:
Thermalcycler Protocol:
55C 10min
95C 10min
Cycle 30-40x:
95C 20sec
60C 60sec for <1kb *do 90sec*
4C
Primer Pairs:
☐ STRAIN1d(CEN.PK.113-5D + p1 + p2 + p3)
☐ Knock out CEN.PK.113-5D (Cas9)
☐ StNESS1 (p1 + p2 + p3)
☐ Prep for HPLC Analysis
Page updated
Google Sites
Report abuse